J Genomics 2018; 6:53-62. doi:10.7150/jgen.24788 This volume Cite

Research Paper

Identification of Sex-associated SNPs of Greater Amberjack (Seriola dumerili)

Junya Kawase1 Corresponding address, Jun-ya Aoki2, Kazuhisa Hamada3, Akiyuki Ozaki2, Kazuo Araki2 Corresponding address

1. Department of Life Sciences, Graduate School of Bioresources, Mie University, 1577 Kurimamachiya-cho, Tsu City, Mie 514-8507, Japan
2. Research Center for Aquatic Breeding, National Research Institute of Aquaculture, Fisheries Research Agency, 224 Hiruda, Tamaki-cho, Watarai, Mie 519-0423, Japan
3. Marine Farm Laboratory Limited Company, 309 Takahiro, Tachibaura, Otsuki-cho, Hata-gun, Kochi 788-0352, Japan

Received 2018-1-7; Accepted 2018-4-25; Published 2018-5-19

Citation:
Kawase J, Aoki Jy, Hamada K, Ozaki A, Araki K. Identification of Sex-associated SNPs of Greater Amberjack (Seriola dumerili). J Genomics 2018; 6:53-62. doi:10.7150/jgen.24788. https://www.jgenomics.com/v06p0053.htm
Other styles

File import instruction

Abstract

Graphic abstract

The sex determination systems of fish are highly diverse compared with those of mammals. Thus, performing investigations using nonmodel fish species helps to understand the highly diverse sex determination systems of fish. Because greater amberjack (Seriola dumerili) is one of the most important edible fish globally and knowledge of its sex determination system is economically important in the field of aquaculture, we are interested in the mechanisms of sex determination of Seriola species. In this study, we identified sex-associated SNPs of greater amberjack using SNP information of 10 males and 10 females by an association test. We determined that the sex-associated SNPs were on chromosome 12 and mainly covered with two scaffolds (about 7.1 Mbp). Genotypes of sex-associated SNPs indicated that females are the heterogametic sex (ZZ/ZW). Furthermore, we compared the genomic structure of greater amberjack with those of Japanese amberjack (Seriola quinqueradiata), California yellowtail (Seriola dorsalis), and medaka (Oryzias latipes). Whole-genome alignments and synteny analysis indicated that the sex determination system of greater amberjack is markedly different from that of medaka and implied that the sex determination system is conserved in the Seriola species.

Keywords: sex determination system, genome-wide association study, heterogametic female, synteny, Seriola dumerili

Introduction

The sex determination systems of fish are highly diverse, while sex is determined by the Sry gene on the Y chromosome in most mammals [1]. Although sex is determined genetically in many fish species, it is also affected by environmental factors (e.g., exogenous steroids and temperature) and some fish change sex at a certain growth stage. Various genes have been identified as master sex genes in fish, for example, Dmy of Japanese medaka (Oryzias latipes) [2], GsdfY of Oryzias luzonensis [3], Sox3 of Oryzias dancena [4], Amhy of Odontesthes hatcheri [5], Amhr2 of torafugu (Takifugu rubripes) [6], Dmrt1 of tongue sole (Cynoglossus semilaevis) [7], and SdY of rainbow trout (Oncorhynchus mykiss) [8]. Therefore, researching these systems of various fish species is valuable to boost our understanding of sex determination systems in general and their evolution in fish in particular.

We are interested in whether the same gene acts as an SD gene in the genus Seriola. We already know that the yellowtail sex-determining gene is at the end of linkage group 12 [9]. In addition, the sex-determining region of California yellowtail (Seriola dorsalis) has been identified and it has been hypothesized that estradiol 17-beta-dehydrogenase is the putative sex-determining gene [10].

Japanese amberjack (Seriola quinqueradiata) and greater amberjack (Seriola dumerili) are the main species for aquaculture production in Japan. Knowledge of their sex determination process is valuable given the importance of controlling the sex ratio in aquaculture.

These two Seriola species are taxonomically close and their genome and transcriptome sequences are available [11-13]. We focused on this issue and also examined specifically whether the same gene acts as an SD gene in the Seriola species.

In this study, we identified sex-associated SNPs of greater amberjack and indicated that most of these SNPs are present on chromosome 12. Furthermore, we compared the genomic structure of greater amberjack with those of medaka, Japanese amberjack, and California yellowtail, and indicated that the sex determination system of greater amberjack is markedly different from that of medaka. However, the findings show that the SD region is conserved in the Seriola species.

Materials and Methods

Data collection

Genomic sequences of greater amberjack and yellowtail were retrieved from the DNA Data Bank of Japan (DDBJ) (greater amberjack: BDQW01000001-BDQW01034655, yellowtail: BDMU01000001-BDMU01000384). Genome scaffold sequences of greater amberjack and yellowtail were combined into each chromosome based on a previously published physical genetic map [12]. We also obtained transcriptome data of greater amberjack from DDBJ (greater amberjack: IACO01000001-IACO01045109, yellowtail: IACH01000001-IACH01013125). The sequence variation data of greater amberjack were obtained in a previous study [13].

The complementary DNA (cDNA) sequences of medaka were obtained from Ensembl [14]. The chromosome-level assembly of medaka was obtained from NCBI Assembly (ASM31367v1) [15]. The genome assembly of California yellowtail was obtained from GenBank (GCA_002814215.1) [10].

Synteny analysis

To identify orthologs, a nucleotide-to-nucleotide BLAST (blastn) search was performed between greater amberjack cDNA sequences and yellowtail cDNA sequences using an e-value cut-off of 1e-10 and reciprocal best hits. A translated-nucleotide-to-translated-nucleotide BLAST (tblastx) search was also performed between greater amberjack cDNA sequences and Japanese medaka cDNA sequences using an e-value cut-off of 1e-5 and reciprocal best hits. The orthologs were aligned to the genetic map of each species to identify syntenic relationships. Then, we constructed Circos plots [16] to illustrate the syntenic relationships.

Whole-genome alignments

Interspersed repeats and low-complexity DNA sequences of each genome assembly were masked using Tandem repeats finder [17] and Repeatmasker [18] with the following option: species “teleost fish.” Then, whole-genome alignments of each orthologous chromosome between greater amberjack (Sdu) and yellowtail (Squ) were performed using LASTZ [19] with the following options: no transition, step=20, and chain.

Whole-genome alignments of each orthologous chromosome between greater amberjack and Japanese medaka (Ola) were also performed using LASTZ [19] with the following options: transition, step=20, and chain.

Genomic sequence alignments between Sdu chromosome 12 and the scaffold sequence (PEQF01098998.1) that contains the Hsd17b1 gene of California yellowtail (Sdo) were performed using LASTZ with the following options: no transition, step=20, and chain.

After removing alignments that were shorter than the thresholds (Sdu vs. Squ and Sdu vs. Sdo: 400, Sdu vs. Ola: 150) from Rdotplot files generated from LASTZ, the alignment blocks were plotted by R [20].

Sex-determining SNP identification

Biallelic SNP information of 10 males and 10 females was extracted from the sequence variation data of greater amberjack. Those SNPs with a minor allele frequency of less than 0.2 or missing data for more than two individuals were filtered out. An association test was performed by GWASpoly [21] with the 1-dom model and false discovery rate level = 0.01. Haplotypes were estimated by PHASE v2.1.1 [22,23] from the genotype data included in the result of GWASPoly. To identify the proteins into which the transcripts in greater amberjack translate, a translated nucleotide-to-protein BLAST search (blastx) of the greater amberjack transcriptome sequences against protein sequences of RefSeq vertebrate other (release 69) [24] was performed with an e-value cut-off of 0.01.

The study that identified the sex-determining locus of Seriola dorsalis showed that there is a female-specific 61-nucleotide deletion and that estradiol 17-beta-dehydrogenase 1 (Hsd17b1) is the putative sex-determining gene [10]. To check whether greater amberjack has the female-specific deletion, we extracted indel variations near Hsd17b1 (between 50 kb upstream and downstream) from the variation data of greater amberjack and investigated the existence of a female-specific deletion.

Results

Synteny analysis

Between greater amberjack and yellowtail, 10,258 entries were identified as orthologs. The chromosomes that are thought to be orthologous chromosomes shared the orthologs and retained the order of those orthologs; in addition, inter-chromosomal translocations were observed at low frequency (Figure 1A). Between greater amberjack and medaka, 14,037 entries were identified as orthologs. The chromosome structure is generally conserved in these two species, but inter-chromosomal rearrangements have occurred more frequently than between greater amberjack and yellowtail (Figure 1B).

 Figure 1 

Circos plots showing conservation of synteny between (A) greater amberjack (right side, multicolored) and yellowtail (left side, gray), and (B) greater amberjack (right side, multicolored) and medaka (left side, gray). Lines linking two chromosomes indicate the location of orthologs.

J Genomics Image

Whole-genome alignments

Pairwise whole-genome alignments of greater amberjack were performed against yellowtail and Japanese medaka with LASTZ [19]. The plots of alignments are shown in Figure 2 (greater amberjack vs. yellowtail) and Figure 3 (greater amberjack vs. Japanese medaka). The alignments between greater amberjack and yellowtail indicated that the chromosome structure was well conserved in these two species and homology of the genome sequences was retained in almost all regions of the genome (Figure 2, Figure S1). Hereafter, we assign the same number to the orthologous chromosomes of these two species using the numbers assigned according to linkage group numbers in a previous genetic map study [11]. In greater amberjack and Japanese medaka, the sequences could be aligned in a large range in some regions (e.g., Sdu2: 4.5-17.8 Mb vs. Ola1: 25.4-8.4 Mb, Sdu3: 7.0-16.7 Mb vs. Ola6: 5.6-16.3 Mb and Sdu4: 17.8-26.0 Mb vs. Ola4: 14.0-23.6 Mb), but chromosomal inversions and intra-chromosomal translocations were frequently observed (Figure 3, Figure S2). Genomic sequence alignments between Sdu12 and the scaffold sequence (PEQF01098998.1) of California yellowtail showed completely linear correspondence (Figure 4).

 Figure 2 

Plots showing the alignment of each orthologous chromosome pair (1-4). The horizontal axis and the vertical axis indicate the positions (base pair) of greater amberjack (Sdu) and yellowtail (Squ), respectively.

J Genomics Image
 Figure 3 

Plots showing the alignment of each orthologous chromosome pair. The horizontal axis and the vertical axis indicate the positions (base pair) of greater amberjack (Sdu) and medaka (Ola), respectively.

J Genomics Image
 Figure 4 

Plots showing the alignment of Sdu12 vs. the scaffold sequence (PEQF01098998.1) that contains the Hsd17b1 gene of California yellowtail.

J Genomics Image

Sex-associated SNP identification

After SNP pruning, 1,797,184 SNPs were used for subsequent analysis. The 1-dom model in GWASpoly was considered to be an appropriate statistical model because minor alleles control sex in both XX/XY and ZW/ZZ sex determination systems. The loci significantly associated with sex in the 1-dom test by GWASpoly are shown in Table 1 and Manhattan plots of the 1-dom-alt and 1-dom-ref models are shown in Figure 5. In 1-dom-alt and 1-dom-ref, it is assumed that the alternative allele and reference allele are dominant, respectively. SNPs associated with sex were mainly covered with two scaffolds, contig43 and contig168, and we found one high-scoring locus, c168_4648290, associated with sex on contig168. The genotypes of sex-associated SNPs are shown in Table 2. Although eight loci (c16_12746979, c43_1018703, c43_1944077, c43_4403196, c168_3069620, c168_4823950, c168_5414906, and c387_222985) were heterozygous in the male and homozygous in the female, or XX/XY system, the other loci were heterozygous in the female and homozygous in the male, or ZZ/ZW system (Table 2), and localized on chromosome 12. We define the SD region as the region with significant SNPs on chromosome 12 in this paper. This region ranges from nucleotide positions 56,399 bp to 4,405,455 bp on contig43 and from 338,405 bp to 5,457,861 bp on contig168 (Table 1). In this SD region on chromosome 12, there are genes that encode proteins associated with sex hormones, such as G-protein-coupled estrogen receptor 1 (GPER), estradiol 17-beta-dehydrogenase 1, 17-beta-hydroxysteroid dehydrogenase 14, and transcription factors SOX8 and SOX9 (Table S1).

 Table 1 

Output from GWASpoly. The softoware was run with 1-dom model and FDR level = 0.01

TraitModelThresholdMarkerChromPositionRefAltScoreEffect
sex1-dom-alt5.25c43_4405455126857868017.360.91
sex1-dom-alt5.25c43_3763669127499654017.360.91
sex1-dom-alt5.25c43_3697080127566243017.360.91
sex1-dom-alt5.25c43_3027521128235802017.360.91
sex1-dom-alt5.25c43_1782220129481103017.360.91
sex1-dom-alt5.25c43_12298481210033475017.360.91
sex1-dom-alt5.25c43_12214911210041832017.360.91
sex1-dom-alt5.25c43_10187031210244620017.36-0.91
sex1-dom-alt5.25c43_8269371210436386017.360.91
sex1-dom-alt5.25c43_5737051210689618017.360.91
sex1-dom-alt5.25c43_4705871210792736017.360.91
sex1-dom-alt5.25c43_3587261210904597017.360.91
sex1-dom-alt5.25c43_3309731210932350017.360.91
sex1-dom-alt5.25c43_3172361210946087017.360.91
sex1-dom-alt5.25c43_3167561210946567017.360.91
sex1-dom-alt5.25c43_1904041211072919017.360.91
sex1-dom-alt5.25c43_968321211166491017.360.91
sex1-dom-alt5.25c43_948191211168504017.360.91
sex1-dom-alt5.25c43_563991211206924017.360.91
sex1-dom-alt5.25c168_54149061211661323017.36-0.91
sex1-dom-alt5.25c168_50071501212069079017.360.91
sex1-dom-alt5.25c168_50065051212069724017.360.91
sex1-dom-alt5.25c168_48239501212252279017.36-0.91
sex1-dom-alt5.25c168_48236851212252544017.360.91
sex1-dom-alt5.25c168_46483491212427880017.360.91
sex1-dom-alt5.25c168_4648290121242793901275.241
sex1-dom-alt5.25c168_45360971212540132017.360.91
sex1-dom-alt5.25c168_41471901212929039017.360.91
sex1-dom-alt5.25c168_36416611213434568017.360.91
sex1-dom-alt5.25c168_33764581213699771017.360.91
sex1-dom-alt5.25c168_32870141213789215017.360.91
sex1-dom-alt5.25c168_31602301213915999017.360.91
sex1-dom-alt5.25c168_31096251213966604017.360.91
sex1-dom-alt5.25c168_3384051216737824017.360.91
sex1-dom-alt5.25c82_71361245556130017.360.91
sex1-dom-alt5.25c82_71360245556131017.360.91
sex1-dom-alt5.25c82_71357245556134017.360.91
sex1-dom-ref5.25c65_3467901129094626017.36-0.91
sex1-dom-ref5.25c43_4403196126860127017.360.91
sex1-dom-ref5.25c43_4287549126975774017.36-0.91
sex1-dom-ref5.25c43_2438162128825161017.36-0.91
sex1-dom-ref5.25c43_1944077129319246017.360.91
sex1-dom-ref5.25c43_8271151210436208017.36-0.91
sex1-dom-ref5.25c43_3623031210901020017.36-0.91
sex1-dom-ref5.25c168_54578611211618368017.36-0.91
sex1-dom-ref5.25c168_49963481212079881017.36-0.91
sex1-dom-ref5.25c168_34444101213631819017.36-0.91
sex1-dom-ref5.25c168_31163501213959879017.36-0.91
sex1-dom-ref5.25c168_30696201214006609017.360.91
sex1-dom-ref5.25c16_12746979154013786017.360.91
sex1-dom-ref5.25c387_222985224833093017.360.91
 Figure 5 

Manhattan plots displaying the result of the 1-dom test by GWASpoly. The horizontal axis indicates the chromosome number and the position of each SNP. The vertical axis indicates the negative logarithm of the P-value for each SNP. Each dot signifies an SNP. The broken line indicates the threshold FDR level of 0.01.

J Genomics Image
 Table 2 

Genotype data of SNPs detected by GWASpoly. Homozygous is indicated by one letter. M1, M2, .. M10 are male IDs. F1, F2, .. F10 are female IDs.

Genotype of each sample
MarkerchrpositionM1M2M3M4M5M6M7M8M9M10F1F2F3F4F5F6F7F8F9F10
c43_4405455126857868AAAAAAAGAAAGAGGAGAGGAGAGAGAG
c43_3763669127499654TTTTTTTGTTTGTGGTGTGGTGTGTGTG
c43_3697080127566243GGGGGGGAGGGAGAAGAGAAGAGAGAGA
c43_3027521128235802GGGGGGGAGGGGAGAGAGAGAAGAGAGAGA
c43_1782220129481103GGGGGGGTGGGTGTGTGTGTTGTGTGTGT
c43_12298481210033475CTCCCCCCCCCCTTCTCTCTCTCTCTCTCT
c43_12214911210041832TTCTTTTTTTTTCTCTCTCTCTCTCTCTCTC
c43_10187031210244620AGGAGAGGAGAGAGAGAGAAAAAAAAAGA
c43_8269371210436386TTTTTTTTTTTATATTATATATATATATA
c43_5737051210689618TATTTTTTTTTTATAATATATATATATATA
c43_4705871210792736AAAAAAAAAAACACACACACACACACAC
c43_3587261210904597CCCCCCCCCCCCACACACACACACACACA
c43_3309731210932350CACCCCCCCCCCACACACACACACACACACA
c43_3172361210946087AAAAAAAAAAAGAGAGAGAAGAGAGAGAG
c43_3167561210946567TTTTTTTTTTTCTCTCTTCTCTCTCTCTC
c43_1904041211072919AAAATAAAAAATATATATATATATATATAT
c43_968321211166491CCCCCCCCCCCTCTCTCCTCTCTCTCTCT
c43_948191211168504TTTTTTTTTTTCTCTCTTCTCTCTCTCTC
c43_563991211206924TTTTTTTTTTTCTCTCTTCTCTCTCTCTC
c168_54149061211661323TCTCTCTCCTCTCTCTCTCTTTTTTTTTCT
c168_50071501212069079AGGGGGGGGGGAGAGAGAGAGAGAGAGAGA
c168_50065051212069724GAAAAAAAAAAGAGAGAGAGAGAGAGAGAG
c168_48239501212252279AGAGAGAAGAGAGAGAGAGGGGGGGGGAG
c168_48236851212252544TTTTTTTTTTTCCTCTTCTCTCTCTCTC
c168_46483491212427880GGGGGGGGGGGAGGAGAGAGAGAGAGAGA
c168_46482901212427939AAAAAAAAAAATATATTATATATATATAT
c168_45360971212540132AAAAAAAAAAAAGAGAGAGAGAGAGAGAG
c168_41471901212929039CCCCCCCCCCCCTCTCTCTCTCTCTCTCT
c168_36416611213434568GGGGGGGGGGGAGAGAGGAGAGAGAGAGA
c168_33764581213699771AAAAAAAAAAATATATAATATATATATAT
c168_32870141213789215CCCTCCCCCCCCTCTCTCTCTCTCTCTCTCT
c168_31602301213915999CCTCCCCCCCCCTCTCTCTCTCTCTCTCTCT
c168_31096251213966604GGGGGGGGGGGGAGAAGAGAGAGAGAGA
c168_3384051216737824CCCCCCCCTCCTCTCTCTTCTCTCTCTCT
c82_71361245556130AAAAAGAAAAAAGAGAGAGAGAGAGAGGAG
c82_71360245556131AAAAACAAAAAACACACACACACACACCAC
c82_71357245556134AAAAAGAAAAAAGAGAGAGAGAGAGAGGAG
c65_3467901129094626GGGGGGCGGGCCGCCGCGCGCGCCGCG
c43_4403196126860127AAGAGAGAAGAGAGAGAGGGGGGGGGAGG
c43_4287549126975774CCCCCCTCCCCTTCTCTCTCTTCTCTCTC
c43_2438162128825161GGGGGGAGGGGAAGAGAGAGAAGAGAGAG
c43_1944077129319246TCTTCTCTTCTCTCTCTCCCCCCCCCTCC
c43_8271151210436208AAAAAAAAAAGAGAAGAGAGAGAGAGAGA
c43_3623031210901020AAATAAAAAAATTATATATATATATATATA
c168_54578611211618368CCTCCCCCCCTTCTCTTCTCTCTCTCTC
c168_49963481212079881TAAAAAAAAAATATATTTATATATATATA
c168_34444101213631819GCCCCCCCCCCGCGCGGCGCGCGCGCGCGC
c168_31163501213959879CCCCCCCCCCGCCGCGCGCGCGCGCGCGC
c168_30696201214006609TGTGTGTGTTGTGTGTGTGGGGGGGGGTGG
c16_12746979154013786TATATATATATTTATATAAAAAAAAATAA
c387_222985224833093GAGAGGAGAGAGAGAGAGAAAAAAAAAAGA

The reconstructed haplotypes estimated by PHASE from the genotype data are shown in Table 3. All females have haplotypes that are unique to females, while five male individuals (M5, M6 M7, M8, and M10 in Table 4) have two haplotypes that appear in both males and females.

 Table 3 

Haplotypes estimated by PHASE software.

No.haplotypes
1AACTGGGTGCTGATTAACCATACTTCCGAAATGAACGCACCCGTC
2AACTGGGTGCTGATTAACCATACTTCCGAAATGAACGCACCCGTT
3AACTGGGTGCTGATTAACCATACTTTCGAAATGAACGCATCCGTC
4AACTGGGTGCTGATTAACAATACTTCCAGAATGAACGCACCCGTC
5AACTGGGCGTTAATAAACCATACTTCTAGTATGAACGGACCCGGC
6AGCTGGGTGCCGATTAACCATACTTCTGAAGTGAACGCACTCGGC
7AGCTGGGCGCTAATTAACCATACTTCTGAAGTGAACGCACCCGGC
8AGCTGGGCGCTAATTAACCATACTTCTGAAGTGAACGCACCCGGT
9AGCTGGGCGCTAATTAACCATACTTTTGATGTGTACGCACCCAGC
10AGCTGGGCGCTAATTAACCATACTTTTGAAGTGAACGCACCCGGC
11AGCTGGGCGCTAATTATCCATTCTTCTGAAGTGAACGCACCCGGC
12AGCTGGGCGTTAATTAACCATACTTCTGAAGCGAACGCACCCGGC
13GGCGAAACTTCAATACTAAGCTTCCTTAGTGCATGTAGTTTGAGT
14GGTGAGGCGCTAATACACCATACTTCTGATGTGAACGGACCCGGC
15GGTGAGACTTCAGAACTCAGCTTCCTTAGTGCATACAGTTTGGGT
16GGTGAAACTCTAATTAACCATACTTCTGAAGTGAACGCACCCGGC
17GGTGAAACTCTAATTATCCATTCTTTTGAAGTGAACGCACCCGGC
18GGTGAAACTTCAGAAATAAGCTTCCTTAGTGCGTGTAGTTTCAGT
19GGTGAAACTTCAGAACTAAACTTCCTTAGTGCATGTAGTTTGAGT
20GGTGAAACTTCAGAACTAAGTTCTTTTAGTGTATGTGGATTGAGT
21GGTGAAACTTCAGAACTAAGCTTCCTTAGTGCATGTAGTTTGAGT
 Table 4 

Haplotype combinations of each individual estimated by PHASE software. The number of haplotype corresponds to table 3.

IDhaplotype combinations
M1(4,5)
M2(1,6)
M3(3,10)
M4(1,11)
M5(1,1)
M6(1,7)
M7(1,16)
M8(1,7)
M9(2,8)
M10(1,7)
F1(15,17)
F2(12,18)
F3(13,14)
F4(9,20)
F5(8,19)
F6(16,21)
F7(7,21)
F8(7,21)
F9(1,21)
F10(7,21)

Indel variations near Hsd17b1 were extracted from the sequence variation data of greater amberjack and we investigated whether a female-specific deletion was present. However, the female-specific deletion could not be found (Table S2).

Discussion

Sex determinant location

By genome-wide sex association analysis, the sex-associated markers were detected on chromosomes (chr)12, 24, 1, 15, and 22 in decreasing order of the number of detected markers on each chromosome. A total of 31 of the 51 sex-associated SNPs are localized on chr12. Sex-associated linkage analysis of yellowtail showed that sex determinants are present on the tip of linkage group 12 [9]. Thus, part of chr12 acts as a sex chromosome in greater amberjack, as well as in yellowtail. Greater amberjack's SD loci were present at scaffolds 168 and 43. These sequences are located in the middle of chr12 and the range of the SD region is approximately 7.1 Mb, if ignoring the gaps between scaffolds.

Comparative analysis

Whole-genome alignments and synteny analysis between yellowtail and greater amberjack showed a very well-conserved chromosome structure (Figure 2). Yellowtail has the ZW/ZZ system and its SD segment is located on Squ12 [9]. The sex-associated marker of greater amberjack is also located at Sdu12, which is a chromosome orthologous to Squ12. The plots of alignment of Sdu12 vs. Squ12 show a linear pattern (Figure S1). Research on the sex-linked SNPs of yellowtail indicated that Gipc1 and Sox9 are present near the SD region [9], which is also the case in greater amberjack. The SD region is present on the tip of the linkage map in yellowtail [9], whereas it is present in the middle of the chromosome in greater amberjack. This is because recombination is suppressed in the sex chromosome and thus the SD region is very narrow on the linkage map of yellowtail.

The alignment of Sdu12 vs. the scaffold sequence (PEQF01098998.1) of California yellowtail also demonstrated well-conserved sequences. Hence, it is inferred that the three Seriola species share sex determination mechanisms because these Seriola species exhibit female heterogamety and have the same genes in orthologous genomic regions.

Medaka has the SD gene on chromosome 1 (Ola1). However, whole-genome alignment showed remarkable homology between Ola8 and Sdu12 (Figure 6). Medaka exhibits male heterogamety and its master SD gene is Dmy. Hence, the Seriola species and medaka clearly have different SD mechanisms and it is thought that SD systems rapidly evolved after the divergence of the common ancestor of those species.

 Figure 6 

Plots showing the alignments between the sequence of the SD region in greater amberjack and (A) medaka chromosome 1 (Ola1) and (B) medaka chromosome 8 (Ola8).

J Genomics Image

Amberjack has the ZW system

In this study, almost all sex-associated SNPs of greater amberjack demonstrated that females are heterozygous (Table 2) and all females have haplotypes that are unique to females (Table 3). Therefore, it is likely that greater amberjack females are the heterogametic sex (ZW/ZZ). SNPs between loci c43_4405455 and c43_1782220 were heterozygous in the male individual (M7 in Table 2) and homozygous in the female individual (F6 in Table 2), so the segment might have undergone recombination. Hence, this SD region may tolerate small-scale recombination and has not yet completely evolved into a sex chromosome.

In the ZW/ZZ system, sex differentiation is caused by the W or Z chromosome. The presence of a W chromosome acts dominantly to lead to the development of a female, while the presence of a Z chromosome leads to the development of a male by a dosage-sensitive mechanism.

Various sex determination mechanisms have been reported in fish species, and in most fish species, heteromorphic sex chromosomes have not been revealed [25]. In the SD region of greater amberjack, there are genes that encode proteins associated with sex hormones, such as G-protein-coupled estrogen receptor 1 (GPER), estradiol 17-beta-dehydrogenase 1, and 17-beta-hydroxysteroid dehydrogenase 14 (Table S1). Sox9 and Sox8 are present in the SD region, so they might be sex determinants. We also found several genes that are expected to be involved in sex differentiation in the SD region.

GPER is activated by estrogen, the main female sex hormone, and plays an important role in female development. In some teleosts, 17-beta estradiol plays a critical role in ovarian differentiation [26-29]. Hence, if the Gper gene or the estradiol 17-beta-dehydrogenase 1 gene in the SD region affects the female pathway and is involved with promoting sex differentiation in greater amberjack, the W chromosome is supposed to induce female differentiation. Recently, Purcell et al. identified the sex-determining region of California yellowtail using genome assembly and re-sequences and hypothesized that the estradiol 17-beta-dehydrogenase 1 gene was the putative sex-determining gene [10]. Thus, it is assumed that the three Seriola species may retain the same SD region that their common ancestor acquired, and that same gene might be involved in sex determination.

GIPC (PDZ domain-containing protein, which interacts specifically with the C terminus of RGS-GAIP) was originally identified as a protein that binds to the C terminus of the RGS (G protein signaling regulator) protein GAIP (RGS19), a GTPase-activating protein (GAP) for Gαi subunits [30]. Endoglin, which is one of the PDZ ligands, interacts with GIPC and specifically enhances the TGF-β1-induced phosphorylation of Smad1/5/8 [31]. Testicular TGF-β1 modulates Leydig cell steroidogenesis, the organization of peritubular myoid cells, testis development, and spermatogenesis [32]. Therefore, although the role of endoglin in the reproductive system has not been shown, GPIC1 might play a role in sex determination in greater amberjack.

SOX9 and SOX8 are group E SOX proteins. These transcription factors contain, besides a DNA-binding HMG domain and a transactivation domain, a DNA-dependent dimerization domain, unique among SOX proteins. In mammals, Sox9 is activated by SRY in pre-Sertoli cells and induces Sertoli cell and testis cord differentiation [33]. SOX9 binds to a SOX binding site within the Amh promoter and interacts with SF1 to synergistically activate Amh expression [34]. SOX8 has the same mechanism of action as SOX9, but acts less efficiently [35]. In many teleosts such as medaka, zebrafish, three-spine stickleback, and rice field eel, Sox9a and/or Sox9b are expressed in gonad [36-41]. In greater amberjack, Sox9 and Sox8 are present in the SD region, so they might be sex determinants.

Although we found several genes that are expected to be involved in sex differentiation in the SD region, the molecular mechanisms of sex differentiation need to be investigated. We will attempt to determine which among these candidate genes is key for the sex determination of greater amberjack.

Supplementary Material

Supplementary figures.

Attachment

Supplementary tables.

Attachment

Acknowledgements

This study was funded by the seeds research of the National Research Institute of Aquaculture. We thank Edanz Group (www.edanzediting.com/ac) for editing a draft of this manuscript.

Competing Interests

The authors have declared that no competing interest exists.

References

1. Waters PD, Wallis MC, Graves JAM. Mammalian sex—Origin and evolution of the Y chromosome and SRY. Semin Cell Dev Biol. 2007;18(3):389-400

2. Matsuda M, Nagahama Y, Shinomiya A. et al. DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature. 2002;417(6888):559-563

3. Myosho T, Otake H, Masuyama H. et al. Tracing the emergence of a novel sex-determining gene in medaka, Oryzias luzonensis. Genetics. 2012;191(1):163-170

4. Takehana Y, Matsuda M, Myosho T. et al. Co-option of Sox3 as the male-determining factor on the Y chromosome in the fish Oryzias dancena. Nat Commun. 2014;5:4157

5. Hattori RS, Strüssmann CA, Fernandino JI, Somoza GM. Genotypic sex determination in teleosts: insights from the testis-determining amhy gene. Gen Comp Endocrinol. 2013;192:55-59

6. Kamiya T, Kai W, Tasumi S. et al. A trans-species missense SNP in Amhr2 is associated with sex determination in the tiger pufferfish, Takifugu rubripes (fugu). Peichel CL, ed. PLoS Genet. 2012;8(7):e1002798

7. Cui Z, Liu Y, Wang W. et al. Genome editing reveals dmrt1 as an essential male sex-determining gene in Chinese tongue sole (Cynoglossus semilaevis). Sci Rep. 2017;7:42213

8. Yano A, Guyomard R, Nicol B. et al. An immune-related gene evolved into the master sex-determining gene in rainbow trout, Oncorhynchus mykiss. Curr Biol. 2012;22(15):1423-1428

9. Koyama T, Ozaki A, Yoshida K. et al. Identification of sex-linked SNPs and sex-determining regions in the yellowtail genome. Mar Biotechnol. 2015;17(4):502-510

10. Purcell CM, Seetharam AS, Snodgrass O, Ortega-García S, Hyde JR, Severin AJ. Insights into teleost sex determination from the Seriola dorsalis genome assembly. BMC Genomics. 2018;19(1):1-11

11. Aoki J, Kai W, Kawabata Y. et al. Second generation physical and linkage maps of yellowtail (Seriola quinqueradiata) and comparison of synteny with four model fish. BMC Genomics. 2015;16(1):406

12. Kawase J, Aoki J, Araki K. Constructing a “Chromonome” of yellowtail ( Seriola quinqueradiata ) for comparative analysis of chromosomal rearrangements. J Genomics. 2018;6:9-19

13. Araki K, Aokic J, Kawase J. et al. Whole genome sequencing of greater amberjack ( Seriola dumerili ) for snp identification on aligned scaffolds and genome structural variation analysis using parallel resequencing. Int J Genomics. 2018;2018:1-12

14. Aken BL, Achuthan P, Akanni W. et al. Ensembl 2017. Nucleic Acids Res. 2017;45(D1):D635-D642

15. Kasahara M, Naruse K, Sasaki S. et al. The medaka draft genome and insights into vertebrate genome evolution. Nature. 2007;447(7145):714-719

16. Krzywinski M, Schein J, Birol I. et al. Circos: An information aesthetic for comparative genomics. Genome Res. 2009;19(9):1639-1645

17. Benson G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999;27(2):573-580

18. Smit A, Hubley R, Green P. RepeatMasker Open-4.0. http://www.repeatmasker.org/

19. Harris RS. Improved Pairwise Alignment of Genomic DNA. TPhD thesis, Pennsylvania State University. 2007

20. R_Core_Team. R: A language and environment for statistical computing. https://www.r-project.org/

21. Rosyara UR, De Jong WS, Douches DS, Endelman JB. Software for genome-wide association studies in autopolyploids and its application to potato. Plant Genome. 2016;9(2):1-10

22. Stephens M, Smith NJ, Donnelly P. A new statistical method for haplotype reconstruction from population data. Am J Hum Genet. 2001;68(4):978-989

23. Stephens M, Scheet P. Accounting for decay of linkage disequilibrium in haplotype inference and missing-data imputation. Am J Hum Genet. 2005;76(3):449-462

24. O'Leary NA, Wright MW, Brister JR. et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44(D1):D733-D745

25. Devlin RH, Nagahama Y. Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture. 2002;208(3-4):191-364

26. Kobayashi T, Kajiura-Kobayashi H, Nagahama Y. Induction of XY sex reversal by estrogen involves altered gene expression in a teleost, tilapia. Cytogenet Genome Res. 2003;101(3-4):289-294

27. Miyata S, Kubo T. In vitro effects of estradiol and aromatase inhibitor treatment on sex differentiation in Xenopus laevis gonads. Gen Comp Endocrinol. 2000;119(1):105-110

28. Rashid H, Kitano H, Hoon Lee K. et al. Fugu (Takifugu rubripes) sexual differentiation: CYP19 regulation and aromatase inhibitor induced testicular development. Sex Dev. 2007;1(5):311-322

29. Piferrer F, Zanuy S, Carrillo M, Solar II, Devlin RH, Donaldson EM. Brief treatment with an aromatase inhibitor during sex differentiation causes chromosomally female salmon to develop as normal, functional males. J Exp Zool. 1994;270(3):255-262

30. De Vries L, Lou X, Zhao G, Zheng B, Farquhar MG. GIPC, a PDZ domain containing protein, interacts specifically with the C terminus of RGS-GAIP. Proc Natl Acad Sci U S A. 1998;95(21):12340-12345

31. Lee NY, Ray B, How T, Blobe GC. Endoglin promotes transforming growth factor β-mediated Smad 1/5/8 signaling and inhibits endothelial cell migration through its association with GIPC. J Biol Chem. 2008;283(47):32527-32533

32. Rocio GC, Saul CR, Silvia Ines G-C. Testicular expression of the TGF-β1 system and the control of Leydig cell proliferation. Adv Biosci Biotechnol. 2013;04(10):1-7

33. Barrionuevo F, Scherer G. SOX E genes: SOX9 and SOX8 in mammalian testis development. Int J Biochem Cell Biol. 2010;42(3):433-436

34. De Santa Barbara P, Bonneaud N, Boizet B. et al. Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Müllerian hormone gene. Mol Cell Biol. 1998;18(11):6653-6665

35. Schepers G, Wilson M, Wilhelm D, Koopman P. Sox8 is expressed during testis differentiation in mice and synergizes with SF1 to activate the Amh promoter in vitro. J Biol Chem. 2003;278(30):28101-28108

36. Chiang EF-L, Pai CI, Wyatt M, Yan YL, Postlethwait J, Chung B. Two sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev Biol. 2001;231(1):149-163

37. Cresko WA, Yan Y-L, Baltrus DA. et al. Genome duplication, subfunction partitioning, and lineage divergence: Sox9 in stickleback and zebrafish. Dev Dyn. 2003;228(3):480-489

38. Nakamoto M, Suzuki A, Matsuda M, Nagahama Y, Shibata N. Testicular type Sox9 is not involved in sex determination but might be in the development of testicular structures in the medaka, Oryzias latipes. Biochem Biophys Res Commun. 2005;333(3):729-736

39. Ijiri S, Kaneko H, Kobayashi T. et al. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus. Biol Reprod. 2008;78(2):333-341

40. Zhou R, Liu L, Guo Y. et al. Similar gene structure of two Sox9a genes and their expression patterns during gonadal differentiation in a teleost fish, rice field eel (Monopterus albus). Mol Reprod Dev. 2003;66(3):211-217

41. Paul-Prasanth B, Nakamura M, Nagahama Y. Sex Determination in Fishes. In: (ed.) Norris DO, Lopez KH. Hormones and Reproduction of Vertebrates. Cambridge, MA: Academic Press. 2011:1-14

Author contact

Corresponding address Corresponding authors: Junya Kawase, 515d303mie-u.ac.jp, Tel.: +81 59-231-9626, ext. 2531, fax: +81 59-231-9634 and Kazuo Araki, arakingo.jp, Tel.: +81 596-58-6411, fax: +81 596-58-6413


Citation styles

APA
Kawase, J., Aoki, J.y., Hamada, K., Ozaki, A., Araki, K. (2018). Identification of Sex-associated SNPs of Greater Amberjack (Seriola dumerili). Journal of Genomics, 6, 53-62. https://doi.org/10.7150/jgen.24788.

ACS
Kawase, J.; Aoki, J.y.; Hamada, K.; Ozaki, A.; Araki, K. Identification of Sex-associated SNPs of Greater Amberjack (Seriola dumerili). J. Genomics 2018, 6, 53-62. DOI: 10.7150/jgen.24788.

NLM
Kawase J, Aoki Jy, Hamada K, Ozaki A, Araki K. Identification of Sex-associated SNPs of Greater Amberjack (Seriola dumerili). J Genomics 2018; 6:53-62. doi:10.7150/jgen.24788. https://www.jgenomics.com/v06p0053.htm

CSE
Kawase J, Aoki Jy, Hamada K, Ozaki A, Araki K. 2018. Identification of Sex-associated SNPs of Greater Amberjack (Seriola dumerili). J Genomics. 6:53-62.

This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions.
Popup Image